multi tissue dissociation kit miltenyi biotec (Miltenyi Biotec)

Miltenyi Biotec is a verified supplier

Miltenyi Biotec manufactures this product

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Miltenyi Biotec multi tissue dissociation kit miltenyi biotec
Multi Tissue Dissociation Kit Miltenyi Biotec, supplied by Miltenyi Biotec, used in various techniques. Bioz Stars score: 96/100, based on 265 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/multi+tissue+dissociation+kits+miltenyi/Multi+Tissue+Dissociation+Kit+1/pm42462708-302-68-71
Average 96 stars, based on 265 article reviews

multi tissue dissociation kit miltenyi biotec - by Bioz Stars, 2026-10

96/100 stars

Images

Isolation:

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Oxaliplatin Sanofi N/A Calcium folinatc Yaoyou N/A InVivo MAb anti-mouse PD-1 BioXcell Cat# BE0146 Macrophage colony-stimulating factor (MCSF) Sinobiological Cat# 11792-HNAH-B Zate Life Advanced DNA RNA Zate Life Cat# AD600150 Phorbol 12-myristate 13-acetate (PMA) MedChemExpress Cat# HY-18739 p-Cresyl sulfate potassium (pCS) MedChemExpress Cat# HY-111431A Ionomycin MedChemExpress Cat# HY-13434 NV-5138 MedChemExpress Cat# HY-114384 C16-PAF MedChemExpress Cat# HY-108635 Cycloheximide (CHX) MedChemExpress Cat# HY-12320 Omeprazole MedChemExpress Cat# HY-B0113 Chlorpromazine MedChemExpress Cat# HY-12708 Methyl-b-cyclodextrin (MbCD) MedChemExpress Cat# HY-101461 Wortmannin Beyotime Cat# S1952 Cytochalasin D GLPBIO CAS No.:22144-77-0 Critical commercial assays Mouse tumor infiltrating tissue mononuclear cell separating solution kit Solarbio Cat# P3970 Mouse lymphocyte isolation kit (peripheral blood) TBD Cat# LTS1092 Mouse lymphocyte isolation kit (tissue/ splenic) Solarbio Cat# P9000 Human peripheral blood lymphocyte isolation kit Solarbio Cat# P8610 EasySep Human CD8+ T Cell Isolation Kit STEMCELL Cat# 17953 EasySep Mouse CD8+ T Cell Isolation Kit STEMCELL Cat# 19753 Human Peripheral Blood Monocyte Isolation Solution kit Solarbio Cat# P8680 Human CD3/CD28 T Cell Activation Beads Biolegend Cat# 422604 Multi Tissue Dissociation Kits Miltenyi Cat# 130-110-201 Dynabeads Mouse T-Activator CD3/CD28 ThermoFisher Cat# 11452D SimpleChIP Enzymatic Chromatin IP Kit (Magnetic Beads) Cell Signaling Technology Cat# 9003S Mouse Nicotinamide ELISA kit Boshen Cat# BS-E19460M1 Mouse N-Methylnicotinamide ELISA kit Boshen Cat# BS-E19520M1 Human nicotinamide ELISA kit CAMILO BIOLOGICAL Cat# 2H-KMLJh312339 Human N-Methylnicotinamide ELISA kit CAMILO BIOLOGICAL Cat# 2H-KMLJh315351 NAD(H) assay kit Solarbio Cat# BC0315 BCA Protein Assay Kit Fdbio science Cat# FD2001 Tag-it Violet Proliferation and Cell Tracking Dye Biolegend Cat# 425101 Cell membrane Green fluorescent probe (DiO) Beyotime Cat# C1038 Cell membrane Red fluorescent probe (DiL) Beyotime Cat# C1036 OptiDensity Iodoxanol solution, 60%(w/v) BasalMedia Cat# R714JV Protein A/G-sepharose 7sea biotech Cat# P001-3 Nuclear and Cytoplasmic Protein Extraction Kit Fdbio science Cat# FD0199 (Continued on next page) Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024 e3

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data The raw data of single cell RNA sequencing This paper HRA007163 TCGA pan-cancer cohorts (HNSC, NSCLC, COAD, SKCM) https://portal.gdc.cancer.gov/ N/A Gastric cancer RNA-seq data Cristescu et al.71; Kim et al.72 GEO: GSE62254; http://tide.dfci. harvard.edu/ Raw data used to generate figures Data S1 N/A Experimental models: Cell lines Mouse MFC Qunxian Technology Co., Ltd RRID: CVCL_5J48 Human HSF NEWGAINBIO Co., Ltd RRID: CVCL_9V78 Mouse YTN-16 Yamamoto et al.73 N/A Primary fibroblast from human GC tissue This paper N/A Primary fibroblast from subcutaneous tumor of C57BL/6 mice This paper N/A Primary lymphocyte from human blood This paper N/A Primary lymphocyte from C57BL/6 mice blood This paper N/A Primary lymphocyte from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from bone marrow of C57BL/6 mice This paper N/A Primary macrophage from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from human blood This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 (Male, 4- to 6-week-old) Experimental Animal Center, Southern Medical University N/A Oligonucleotides siRNA targeting sequence: NNMT si1-GCTCAAGAGCAGCTACTACAT; si2-ATTCTGCCTAGACGGTGTGAA TSINGKE This paper siRNA targeting sequence: NAMPT si1-CCTACAAGGTTACTCACTATA; si2-GTAACTTAGATGGTCTGGAAT TSINGKE This paper siRNA targeting sequence: RAB27a si1-GCAAGTTCAACTCCAAATT; si3-GCCAACGGGACAAACATAA RIBOBIO This paper siRNA negative control: CCGG GGTTCTCCGAACGTGTCACGT CTCGAGACGTGACACGTTCGG AGAACCTTTTTG TSINGKE This paper Gene Expression Vector TSINGKE pCDNA3.1(+)-NC Overexpression Vector: RBP-J TSINGKE pCDNA3.1(+)-Rbpj Overexpression Vector: NNMT TSINGKE pCDNA3.1(+)-Nnmt Overexpression Vector: NAMPT TSINGKE pCDNA3.1(+)-Nampt Expression Vectors: NICD-WT TSINGKE pcDNA3-N-Flag Expression Vectors: NICD-14KR TSINGKE pcDNA3-N-Flag Primers for RT-qPCR Table S7 N/A Software and algorithms R version 4.3.1 R Foundation http://www.R-project.org; RRID: SCR_023486 (Continued on next page) e4 Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024

Cell Isolation:

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data The raw data of single cell RNA sequencing This paper HRA007163 TCGA pan-cancer cohorts (HNSC, NSCLC, COAD, SKCM) https://portal.gdc.cancer.gov/ N/A Gastric cancer RNA-seq data Cristescu et al.71; Kim et al.72 GEO: GSE62254; http://tide.dfci. harvard.edu/ Raw data used to generate figures Data S1 N/A Experimental models: Cell lines Mouse MFC Qunxian Technology Co., Ltd RRID: CVCL_5J48 Human HSF NEWGAINBIO Co., Ltd RRID: CVCL_9V78 Mouse YTN-16 Yamamoto et al.73 N/A Primary fibroblast from human GC tissue This paper N/A Primary fibroblast from subcutaneous tumor of C57BL/6 mice This paper N/A Primary lymphocyte from human blood This paper N/A Primary lymphocyte from C57BL/6 mice blood This paper N/A Primary lymphocyte from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from bone marrow of C57BL/6 mice This paper N/A Primary macrophage from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from human blood This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 (Male, 4- to 6-week-old) Experimental Animal Center, Southern Medical University N/A Oligonucleotides siRNA targeting sequence: NNMT si1-GCTCAAGAGCAGCTACTACAT; si2-ATTCTGCCTAGACGGTGTGAA TSINGKE This paper siRNA targeting sequence: NAMPT si1-CCTACAAGGTTACTCACTATA; si2-GTAACTTAGATGGTCTGGAAT TSINGKE This paper siRNA targeting sequence: RAB27a si1-GCAAGTTCAACTCCAAATT; si3-GCCAACGGGACAAACATAA RIBOBIO This paper siRNA negative control: CCGG GGTTCTCCGAACGTGTCACGT CTCGAGACGTGACACGTTCGG AGAACCTTTTTG TSINGKE This paper Gene Expression Vector TSINGKE pCDNA3.1(+)-NC Overexpression Vector: RBP-J TSINGKE pCDNA3.1(+)-Rbpj Overexpression Vector: NNMT TSINGKE pCDNA3.1(+)-Nnmt Overexpression Vector: NAMPT TSINGKE pCDNA3.1(+)-Nampt Expression Vectors: NICD-WT TSINGKE pcDNA3-N-Flag Expression Vectors: NICD-14KR TSINGKE pcDNA3-N-Flag Primers for RT-qPCR Table S7 N/A Software and algorithms R version 4.3.1 R Foundation http://www.R-project.org; RRID: SCR_023486 (Continued on next page) e4 Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024

Activation Assay:

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data The raw data of single cell RNA sequencing This paper HRA007163 TCGA pan-cancer cohorts (HNSC, NSCLC, COAD, SKCM) https://portal.gdc.cancer.gov/ N/A Gastric cancer RNA-seq data Cristescu et al.71; Kim et al.72 GEO: GSE62254; http://tide.dfci. harvard.edu/ Raw data used to generate figures Data S1 N/A Experimental models: Cell lines Mouse MFC Qunxian Technology Co., Ltd RRID: CVCL_5J48 Human HSF NEWGAINBIO Co., Ltd RRID: CVCL_9V78 Mouse YTN-16 Yamamoto et al.73 N/A Primary fibroblast from human GC tissue This paper N/A Primary fibroblast from subcutaneous tumor of C57BL/6 mice This paper N/A Primary lymphocyte from human blood This paper N/A Primary lymphocyte from C57BL/6 mice blood This paper N/A Primary lymphocyte from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from bone marrow of C57BL/6 mice This paper N/A Primary macrophage from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from human blood This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 (Male, 4- to 6-week-old) Experimental Animal Center, Southern Medical University N/A Oligonucleotides siRNA targeting sequence: NNMT si1-GCTCAAGAGCAGCTACTACAT; si2-ATTCTGCCTAGACGGTGTGAA TSINGKE This paper siRNA targeting sequence: NAMPT si1-CCTACAAGGTTACTCACTATA; si2-GTAACTTAGATGGTCTGGAAT TSINGKE This paper siRNA targeting sequence: RAB27a si1-GCAAGTTCAACTCCAAATT; si3-GCCAACGGGACAAACATAA RIBOBIO This paper siRNA negative control: CCGG GGTTCTCCGAACGTGTCACGT CTCGAGACGTGACACGTTCGG AGAACCTTTTTG TSINGKE This paper Gene Expression Vector TSINGKE pCDNA3.1(+)-NC Overexpression Vector: RBP-J TSINGKE pCDNA3.1(+)-Rbpj Overexpression Vector: NNMT TSINGKE pCDNA3.1(+)-Nnmt Overexpression Vector: NAMPT TSINGKE pCDNA3.1(+)-Nampt Expression Vectors: NICD-WT TSINGKE pcDNA3-N-Flag Expression Vectors: NICD-14KR TSINGKE pcDNA3-N-Flag Primers for RT-qPCR Table S7 N/A Software and algorithms R version 4.3.1 R Foundation http://www.R-project.org; RRID: SCR_023486 (Continued on next page) e4 Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024

Chromatin Immunoprecipitation:

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data The raw data of single cell RNA sequencing This paper HRA007163 TCGA pan-cancer cohorts (HNSC, NSCLC, COAD, SKCM) https://portal.gdc.cancer.gov/ N/A Gastric cancer RNA-seq data Cristescu et al.71; Kim et al.72 GEO: GSE62254; http://tide.dfci. harvard.edu/ Raw data used to generate figures Data S1 N/A Experimental models: Cell lines Mouse MFC Qunxian Technology Co., Ltd RRID: CVCL_5J48 Human HSF NEWGAINBIO Co., Ltd RRID: CVCL_9V78 Mouse YTN-16 Yamamoto et al.73 N/A Primary fibroblast from human GC tissue This paper N/A Primary fibroblast from subcutaneous tumor of C57BL/6 mice This paper N/A Primary lymphocyte from human blood This paper N/A Primary lymphocyte from C57BL/6 mice blood This paper N/A Primary lymphocyte from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from bone marrow of C57BL/6 mice This paper N/A Primary macrophage from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from human blood This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 (Male, 4- to 6-week-old) Experimental Animal Center, Southern Medical University N/A Oligonucleotides siRNA targeting sequence: NNMT si1-GCTCAAGAGCAGCTACTACAT; si2-ATTCTGCCTAGACGGTGTGAA TSINGKE This paper siRNA targeting sequence: NAMPT si1-CCTACAAGGTTACTCACTATA; si2-GTAACTTAGATGGTCTGGAAT TSINGKE This paper siRNA targeting sequence: RAB27a si1-GCAAGTTCAACTCCAAATT; si3-GCCAACGGGACAAACATAA RIBOBIO This paper siRNA negative control: CCGG GGTTCTCCGAACGTGTCACGT CTCGAGACGTGACACGTTCGG AGAACCTTTTTG TSINGKE This paper Gene Expression Vector TSINGKE pCDNA3.1(+)-NC Overexpression Vector: RBP-J TSINGKE pCDNA3.1(+)-Rbpj Overexpression Vector: NNMT TSINGKE pCDNA3.1(+)-Nnmt Overexpression Vector: NAMPT TSINGKE pCDNA3.1(+)-Nampt Expression Vectors: NICD-WT TSINGKE pcDNA3-N-Flag Expression Vectors: NICD-14KR TSINGKE pcDNA3-N-Flag Primers for RT-qPCR Table S7 N/A Software and algorithms R version 4.3.1 R Foundation http://www.R-project.org; RRID: SCR_023486 (Continued on next page) e4 Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024

Magnetic Beads:

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data The raw data of single cell RNA sequencing This paper HRA007163 TCGA pan-cancer cohorts (HNSC, NSCLC, COAD, SKCM) https://portal.gdc.cancer.gov/ N/A Gastric cancer RNA-seq data Cristescu et al.71; Kim et al.72 GEO: GSE62254; http://tide.dfci. harvard.edu/ Raw data used to generate figures Data S1 N/A Experimental models: Cell lines Mouse MFC Qunxian Technology Co., Ltd RRID: CVCL_5J48 Human HSF NEWGAINBIO Co., Ltd RRID: CVCL_9V78 Mouse YTN-16 Yamamoto et al.73 N/A Primary fibroblast from human GC tissue This paper N/A Primary fibroblast from subcutaneous tumor of C57BL/6 mice This paper N/A Primary lymphocyte from human blood This paper N/A Primary lymphocyte from C57BL/6 mice blood This paper N/A Primary lymphocyte from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from bone marrow of C57BL/6 mice This paper N/A Primary macrophage from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from human blood This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 (Male, 4- to 6-week-old) Experimental Animal Center, Southern Medical University N/A Oligonucleotides siRNA targeting sequence: NNMT si1-GCTCAAGAGCAGCTACTACAT; si2-ATTCTGCCTAGACGGTGTGAA TSINGKE This paper siRNA targeting sequence: NAMPT si1-CCTACAAGGTTACTCACTATA; si2-GTAACTTAGATGGTCTGGAAT TSINGKE This paper siRNA targeting sequence: RAB27a si1-GCAAGTTCAACTCCAAATT; si3-GCCAACGGGACAAACATAA RIBOBIO This paper siRNA negative control: CCGG GGTTCTCCGAACGTGTCACGT CTCGAGACGTGACACGTTCGG AGAACCTTTTTG TSINGKE This paper Gene Expression Vector TSINGKE pCDNA3.1(+)-NC Overexpression Vector: RBP-J TSINGKE pCDNA3.1(+)-Rbpj Overexpression Vector: NNMT TSINGKE pCDNA3.1(+)-Nnmt Overexpression Vector: NAMPT TSINGKE pCDNA3.1(+)-Nampt Expression Vectors: NICD-WT TSINGKE pcDNA3-N-Flag Expression Vectors: NICD-14KR TSINGKE pcDNA3-N-Flag Primers for RT-qPCR Table S7 N/A Software and algorithms R version 4.3.1 R Foundation http://www.R-project.org; RRID: SCR_023486 (Continued on next page) e4 Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024

Enzyme-linked Immunosorbent Assay:

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data The raw data of single cell RNA sequencing This paper HRA007163 TCGA pan-cancer cohorts (HNSC, NSCLC, COAD, SKCM) https://portal.gdc.cancer.gov/ N/A Gastric cancer RNA-seq data Cristescu et al.71; Kim et al.72 GEO: GSE62254; http://tide.dfci. harvard.edu/ Raw data used to generate figures Data S1 N/A Experimental models: Cell lines Mouse MFC Qunxian Technology Co., Ltd RRID: CVCL_5J48 Human HSF NEWGAINBIO Co., Ltd RRID: CVCL_9V78 Mouse YTN-16 Yamamoto et al.73 N/A Primary fibroblast from human GC tissue This paper N/A Primary fibroblast from subcutaneous tumor of C57BL/6 mice This paper N/A Primary lymphocyte from human blood This paper N/A Primary lymphocyte from C57BL/6 mice blood This paper N/A Primary lymphocyte from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from bone marrow of C57BL/6 mice This paper N/A Primary macrophage from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from human blood This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 (Male, 4- to 6-week-old) Experimental Animal Center, Southern Medical University N/A Oligonucleotides siRNA targeting sequence: NNMT si1-GCTCAAGAGCAGCTACTACAT; si2-ATTCTGCCTAGACGGTGTGAA TSINGKE This paper siRNA targeting sequence: NAMPT si1-CCTACAAGGTTACTCACTATA; si2-GTAACTTAGATGGTCTGGAAT TSINGKE This paper siRNA targeting sequence: RAB27a si1-GCAAGTTCAACTCCAAATT; si3-GCCAACGGGACAAACATAA RIBOBIO This paper siRNA negative control: CCGG GGTTCTCCGAACGTGTCACGT CTCGAGACGTGACACGTTCGG AGAACCTTTTTG TSINGKE This paper Gene Expression Vector TSINGKE pCDNA3.1(+)-NC Overexpression Vector: RBP-J TSINGKE pCDNA3.1(+)-Rbpj Overexpression Vector: NNMT TSINGKE pCDNA3.1(+)-Nnmt Overexpression Vector: NAMPT TSINGKE pCDNA3.1(+)-Nampt Expression Vectors: NICD-WT TSINGKE pcDNA3-N-Flag Expression Vectors: NICD-14KR TSINGKE pcDNA3-N-Flag Primers for RT-qPCR Table S7 N/A Software and algorithms R version 4.3.1 R Foundation http://www.R-project.org; RRID: SCR_023486 (Continued on next page) e4 Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024

Bicinchoninic Acid Protein Assay:

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data The raw data of single cell RNA sequencing This paper HRA007163 TCGA pan-cancer cohorts (HNSC, NSCLC, COAD, SKCM) https://portal.gdc.cancer.gov/ N/A Gastric cancer RNA-seq data Cristescu et al.71; Kim et al.72 GEO: GSE62254; http://tide.dfci. harvard.edu/ Raw data used to generate figures Data S1 N/A Experimental models: Cell lines Mouse MFC Qunxian Technology Co., Ltd RRID: CVCL_5J48 Human HSF NEWGAINBIO Co., Ltd RRID: CVCL_9V78 Mouse YTN-16 Yamamoto et al.73 N/A Primary fibroblast from human GC tissue This paper N/A Primary fibroblast from subcutaneous tumor of C57BL/6 mice This paper N/A Primary lymphocyte from human blood This paper N/A Primary lymphocyte from C57BL/6 mice blood This paper N/A Primary lymphocyte from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from bone marrow of C57BL/6 mice This paper N/A Primary macrophage from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from human blood This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 (Male, 4- to 6-week-old) Experimental Animal Center, Southern Medical University N/A Oligonucleotides siRNA targeting sequence: NNMT si1-GCTCAAGAGCAGCTACTACAT; si2-ATTCTGCCTAGACGGTGTGAA TSINGKE This paper siRNA targeting sequence: NAMPT si1-CCTACAAGGTTACTCACTATA; si2-GTAACTTAGATGGTCTGGAAT TSINGKE This paper siRNA targeting sequence: RAB27a si1-GCAAGTTCAACTCCAAATT; si3-GCCAACGGGACAAACATAA RIBOBIO This paper siRNA negative control: CCGG GGTTCTCCGAACGTGTCACGT CTCGAGACGTGACACGTTCGG AGAACCTTTTTG TSINGKE This paper Gene Expression Vector TSINGKE pCDNA3.1(+)-NC Overexpression Vector: RBP-J TSINGKE pCDNA3.1(+)-Rbpj Overexpression Vector: NNMT TSINGKE pCDNA3.1(+)-Nnmt Overexpression Vector: NAMPT TSINGKE pCDNA3.1(+)-Nampt Expression Vectors: NICD-WT TSINGKE pcDNA3-N-Flag Expression Vectors: NICD-14KR TSINGKE pcDNA3-N-Flag Primers for RT-qPCR Table S7 N/A Software and algorithms R version 4.3.1 R Foundation http://www.R-project.org; RRID: SCR_023486 (Continued on next page) e4 Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024

Cell Tracking Assay:

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data The raw data of single cell RNA sequencing This paper HRA007163 TCGA pan-cancer cohorts (HNSC, NSCLC, COAD, SKCM) https://portal.gdc.cancer.gov/ N/A Gastric cancer RNA-seq data Cristescu et al.71; Kim et al.72 GEO: GSE62254; http://tide.dfci. harvard.edu/ Raw data used to generate figures Data S1 N/A Experimental models: Cell lines Mouse MFC Qunxian Technology Co., Ltd RRID: CVCL_5J48 Human HSF NEWGAINBIO Co., Ltd RRID: CVCL_9V78 Mouse YTN-16 Yamamoto et al.73 N/A Primary fibroblast from human GC tissue This paper N/A Primary fibroblast from subcutaneous tumor of C57BL/6 mice This paper N/A Primary lymphocyte from human blood This paper N/A Primary lymphocyte from C57BL/6 mice blood This paper N/A Primary lymphocyte from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from bone marrow of C57BL/6 mice This paper N/A Primary macrophage from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from human blood This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 (Male, 4- to 6-week-old) Experimental Animal Center, Southern Medical University N/A Oligonucleotides siRNA targeting sequence: NNMT si1-GCTCAAGAGCAGCTACTACAT; si2-ATTCTGCCTAGACGGTGTGAA TSINGKE This paper siRNA targeting sequence: NAMPT si1-CCTACAAGGTTACTCACTATA; si2-GTAACTTAGATGGTCTGGAAT TSINGKE This paper siRNA targeting sequence: RAB27a si1-GCAAGTTCAACTCCAAATT; si3-GCCAACGGGACAAACATAA RIBOBIO This paper siRNA negative control: CCGG GGTTCTCCGAACGTGTCACGT CTCGAGACGTGACACGTTCGG AGAACCTTTTTG TSINGKE This paper Gene Expression Vector TSINGKE pCDNA3.1(+)-NC Overexpression Vector: RBP-J TSINGKE pCDNA3.1(+)-Rbpj Overexpression Vector: NNMT TSINGKE pCDNA3.1(+)-Nnmt Overexpression Vector: NAMPT TSINGKE pCDNA3.1(+)-Nampt Expression Vectors: NICD-WT TSINGKE pcDNA3-N-Flag Expression Vectors: NICD-14KR TSINGKE pcDNA3-N-Flag Primers for RT-qPCR Table S7 N/A Software and algorithms R version 4.3.1 R Foundation http://www.R-project.org; RRID: SCR_023486 (Continued on next page) e4 Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024

Membrane:

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data The raw data of single cell RNA sequencing This paper HRA007163 TCGA pan-cancer cohorts (HNSC, NSCLC, COAD, SKCM) https://portal.gdc.cancer.gov/ N/A Gastric cancer RNA-seq data Cristescu et al.71; Kim et al.72 GEO: GSE62254; http://tide.dfci. harvard.edu/ Raw data used to generate figures Data S1 N/A Experimental models: Cell lines Mouse MFC Qunxian Technology Co., Ltd RRID: CVCL_5J48 Human HSF NEWGAINBIO Co., Ltd RRID: CVCL_9V78 Mouse YTN-16 Yamamoto et al.73 N/A Primary fibroblast from human GC tissue This paper N/A Primary fibroblast from subcutaneous tumor of C57BL/6 mice This paper N/A Primary lymphocyte from human blood This paper N/A Primary lymphocyte from C57BL/6 mice blood This paper N/A Primary lymphocyte from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from bone marrow of C57BL/6 mice This paper N/A Primary macrophage from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from human blood This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 (Male, 4- to 6-week-old) Experimental Animal Center, Southern Medical University N/A Oligonucleotides siRNA targeting sequence: NNMT si1-GCTCAAGAGCAGCTACTACAT; si2-ATTCTGCCTAGACGGTGTGAA TSINGKE This paper siRNA targeting sequence: NAMPT si1-CCTACAAGGTTACTCACTATA; si2-GTAACTTAGATGGTCTGGAAT TSINGKE This paper siRNA targeting sequence: RAB27a si1-GCAAGTTCAACTCCAAATT; si3-GCCAACGGGACAAACATAA RIBOBIO This paper siRNA negative control: CCGG GGTTCTCCGAACGTGTCACGT CTCGAGACGTGACACGTTCGG AGAACCTTTTTG TSINGKE This paper Gene Expression Vector TSINGKE pCDNA3.1(+)-NC Overexpression Vector: RBP-J TSINGKE pCDNA3.1(+)-Rbpj Overexpression Vector: NNMT TSINGKE pCDNA3.1(+)-Nnmt Overexpression Vector: NAMPT TSINGKE pCDNA3.1(+)-Nampt Expression Vectors: NICD-WT TSINGKE pcDNA3-N-Flag Expression Vectors: NICD-14KR TSINGKE pcDNA3-N-Flag Primers for RT-qPCR Table S7 N/A Software and algorithms R version 4.3.1 R Foundation http://www.R-project.org; RRID: SCR_023486 (Continued on next page) e4 Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024

Protein Extraction:

Article Title: Nicotinamide metabolism face-off between macrophages and fibroblasts manipulates the microenvironment in gastric cancer.
Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data The raw data of single cell RNA sequencing This paper HRA007163 TCGA pan-cancer cohorts (HNSC, NSCLC, COAD, SKCM) https://portal.gdc.cancer.gov/ N/A Gastric cancer RNA-seq data Cristescu et al.71; Kim et al.72 GEO: GSE62254; http://tide.dfci. harvard.edu/ Raw data used to generate figures Data S1 N/A Experimental models: Cell lines Mouse MFC Qunxian Technology Co., Ltd RRID: CVCL_5J48 Human HSF NEWGAINBIO Co., Ltd RRID: CVCL_9V78 Mouse YTN-16 Yamamoto et al.73 N/A Primary fibroblast from human GC tissue This paper N/A Primary fibroblast from subcutaneous tumor of C57BL/6 mice This paper N/A Primary lymphocyte from human blood This paper N/A Primary lymphocyte from C57BL/6 mice blood This paper N/A Primary lymphocyte from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from bone marrow of C57BL/6 mice This paper N/A Primary macrophage from subcutaneous tumor of C57BL/6 mice This paper N/A Primary macrophage from human blood This paper N/A Experimental models: Organisms/strains Mouse: C57BL/6 (Male, 4- to 6-week-old) Experimental Animal Center, Southern Medical University N/A Oligonucleotides siRNA targeting sequence: NNMT si1-GCTCAAGAGCAGCTACTACAT; si2-ATTCTGCCTAGACGGTGTGAA TSINGKE This paper siRNA targeting sequence: NAMPT si1-CCTACAAGGTTACTCACTATA; si2-GTAACTTAGATGGTCTGGAAT TSINGKE This paper siRNA targeting sequence: RAB27a si1-GCAAGTTCAACTCCAAATT; si3-GCCAACGGGACAAACATAA RIBOBIO This paper siRNA negative control: CCGG GGTTCTCCGAACGTGTCACGT CTCGAGACGTGACACGTTCGG AGAACCTTTTTG TSINGKE This paper Gene Expression Vector TSINGKE pCDNA3.1(+)-NC Overexpression Vector: RBP-J TSINGKE pCDNA3.1(+)-Rbpj Overexpression Vector: NNMT TSINGKE pCDNA3.1(+)-Nnmt Overexpression Vector: NAMPT TSINGKE pCDNA3.1(+)-Nampt Expression Vectors: NICD-WT TSINGKE pcDNA3-N-Flag Expression Vectors: NICD-14KR TSINGKE pcDNA3-N-Flag Primers for RT-qPCR Table S7 N/A Software and algorithms R version 4.3.1 R Foundation http://www.R-project.org; RRID: SCR_023486 (Continued on next page) e4 Cell Metabolism 36, 1806–1822.e1–e11, August 6, 2024

Review